ID: 1144841200_1144841210

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1144841200 1144841210
Species Human (GRCh38) Human (GRCh38)
Location 17:18187098-18187120 17:18187145-18187167
Sequence CCCATGGAGGCCTCAGACAGGAG ACTGCAGAAGCACACTGAAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 333} {0: 1, 1: 1, 2: 3, 3: 23, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!