ID: 1144843078_1144843082

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144843078 1144843082
Species Human (GRCh38) Human (GRCh38)
Location 17:18200549-18200571 17:18200581-18200603
Sequence CCAAGTGGTAACCTAAGCTGGTG CTCTGTGCTAGTACCCGGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 60} {0: 1, 1: 0, 2: 0, 3: 3, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!