ID: 1144847429_1144847434

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1144847429 1144847434
Species Human (GRCh38) Human (GRCh38)
Location 17:18227177-18227199 17:18227208-18227230
Sequence CCCTGCCTAGGTCTGCAGTGATT GAGCTGCCAGGACCCTCACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 220} {0: 1, 1: 1, 2: 2, 3: 12, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!