ID: 1144848713_1144848725

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1144848713 1144848725
Species Human (GRCh38) Human (GRCh38)
Location 17:18233374-18233396 17:18233419-18233441
Sequence CCTCCCAGCTTCTGCAGATGGGG GTCAGGAGATGTCTGAGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 235} {0: 1, 1: 0, 2: 0, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!