ID: 1144858191_1144858202

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1144858191 1144858202
Species Human (GRCh38) Human (GRCh38)
Location 17:18282522-18282544 17:18282569-18282591
Sequence CCTCAAAGGCCTGATCCCACCCT GCCTGCAGGTTGGCAACAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 214} {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!