ID: 1144860842_1144860850

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144860842 1144860850
Species Human (GRCh38) Human (GRCh38)
Location 17:18300823-18300845 17:18300865-18300887
Sequence CCAGGGTCAAAGGGTGGAGTGAG CATGGTCTGCAGAAGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 628} {0: 1, 1: 0, 2: 2, 3: 28, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!