ID: 1144867662_1144867669

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1144867662 1144867669
Species Human (GRCh38) Human (GRCh38)
Location 17:18347271-18347293 17:18347313-18347335
Sequence CCCTCACTGGTTTCCCTGTGGCC CTCCATCCCAGCTGCCCCAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 286} {0: 1, 1: 0, 2: 8, 3: 42, 4: 410}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!