ID: 1144874416_1144874420

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1144874416 1144874420
Species Human (GRCh38) Human (GRCh38)
Location 17:18390037-18390059 17:18390052-18390074
Sequence CCTCATCTCACTGCATGCCACTG TGCCACTGTTCAGGCTCCTGGGG
Strand - +
Off-target summary No data {0: 8, 1: 2, 2: 2, 3: 22, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!