ID: 1144875778_1144875785

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1144875778 1144875785
Species Human (GRCh38) Human (GRCh38)
Location 17:18396425-18396447 17:18396470-18396492
Sequence CCAAAAAGCAGCTTTCTGCACAA CTTCCCAAAGCGCTGACTGTGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 16, 3: 21, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!