ID: 1144892425_1144892427

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1144892425 1144892427
Species Human (GRCh38) Human (GRCh38)
Location 17:18501563-18501585 17:18501580-18501602
Sequence CCATGCGCAAACTGTACCAGCTG CAGCTGCTCCGCCCACACCACGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 0, 3: 9, 4: 78} {0: 4, 1: 0, 2: 0, 3: 26, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!