ID: 1144908018_1144908026

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1144908018 1144908026
Species Human (GRCh38) Human (GRCh38)
Location 17:18653766-18653788 17:18653798-18653820
Sequence CCTGCTATCTTTAGAAAGACTTG TTGGCCACAGGCGGGCATCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 13, 4: 135} {0: 2, 1: 0, 2: 1, 3: 13, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!