ID: 1144911054_1144911065

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1144911054 1144911065
Species Human (GRCh38) Human (GRCh38)
Location 17:18682090-18682112 17:18682129-18682151
Sequence CCCTCGAGGCCCCTTTAACAAAC ACTCGGCACAGAACGACCCGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 0, 4: 52} {0: 2, 1: 0, 2: 0, 3: 0, 4: 10}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!