ID: 1144914034_1144914044

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1144914034 1144914044
Species Human (GRCh38) Human (GRCh38)
Location 17:18707476-18707498 17:18707502-18707524
Sequence CCACTGTTTTGTGATCACCCCCC AGATGAGGGACCCAGTTAATAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 5, 4: 92} {0: 1, 1: 1, 2: 0, 3: 5, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!