ID: 1144921478_1144921482

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1144921478 1144921482
Species Human (GRCh38) Human (GRCh38)
Location 17:18767870-18767892 17:18767894-18767916
Sequence CCAAGAAGGTAGTGTCTGTCCCA ACACAGACCCACCAGGAGCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 155} {0: 2, 1: 0, 2: 1, 3: 31, 4: 334}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!