ID: 1144929372_1144929377

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1144929372 1144929377
Species Human (GRCh38) Human (GRCh38)
Location 17:18846554-18846576 17:18846607-18846629
Sequence CCCAGGCTTGTGGATTGGAGCGA CAAGTGGCCCACATTGATATTGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 1, 3: 11, 4: 115} {0: 2, 1: 1, 2: 2, 3: 17, 4: 62}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!