|
Left Crispr |
Right Crispr |
| Crispr ID |
1144929373 |
1144929377 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:18846555-18846577
|
17:18846607-18846629
|
| Sequence |
CCAGGCTTGTGGATTGGAGCGAG |
CAAGTGGCCCACATTGATATTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 1, 2: 0, 3: 5, 4: 86} |
{0: 2, 1: 1, 2: 2, 3: 17, 4: 62} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|