ID: 1144938473_1144938482

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144938473 1144938482
Species Human (GRCh38) Human (GRCh38)
Location 17:18919086-18919108 17:18919136-18919158
Sequence CCAGGTACTTTGGCGCACTCCTT TGGAAGGTTTGCTTGAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 417} {0: 7, 1: 619, 2: 8143, 3: 27029, 4: 58150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!