|
Left Crispr |
Right Crispr |
Crispr ID |
1144938475 |
1144938482 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:18919105-18919127
|
17:18919136-18919158
|
Sequence |
CCTTTAATCCCAGCACTGTGGAA |
TGGAAGGTTTGCTTGAGCCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 196, 2: 16379, 3: 344193, 4: 257369} |
{0: 7, 1: 619, 2: 8143, 3: 27029, 4: 58150} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|