ID: 1144938475_1144938486

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1144938475 1144938486
Species Human (GRCh38) Human (GRCh38)
Location 17:18919105-18919127 17:18919155-18919177
Sequence CCTTTAATCCCAGCACTGTGGAA CAGGAGTTTGAGACCAGCCTGGG
Strand - +
Off-target summary {0: 2, 1: 196, 2: 16379, 3: 344193, 4: 257369} {0: 19126, 1: 38854, 2: 56666, 3: 50459, 4: 31838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!