ID: 1144956859_1144956867

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1144956859 1144956867
Species Human (GRCh38) Human (GRCh38)
Location 17:19023053-19023075 17:19023073-19023095
Sequence CCAAGGCAGAGCTGGCCCAGGTG GTGGTGAACAGGGAGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 51, 4: 415} {0: 1, 1: 1, 2: 11, 3: 118, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!