ID: 1144971077_1144971084

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1144971077 1144971084
Species Human (GRCh38) Human (GRCh38)
Location 17:19110347-19110369 17:19110391-19110413
Sequence CCCTGACTCATGCTCCGCGCCCC ACTCCCACCCTGATTGGAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!