ID: 1144971082_1144971084

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1144971082 1144971084
Species Human (GRCh38) Human (GRCh38)
Location 17:19110368-19110390 17:19110391-19110413
Sequence CCTGCTGTGAGAAGTCTCTGCTG ACTCCCACCCTGATTGGAGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 21, 4: 219} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!