ID: 1144977700_1144977703

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1144977700 1144977703
Species Human (GRCh38) Human (GRCh38)
Location 17:19148291-19148313 17:19148340-19148362
Sequence CCGGCCTTGAACACATCTTTATC TAAAGCAGCAAGCTGCCCCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 26, 4: 293} {0: 2, 1: 0, 2: 2, 3: 11, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!