ID: 1144986676_1144986685

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1144986676 1144986685
Species Human (GRCh38) Human (GRCh38)
Location 17:19205329-19205351 17:19205357-19205379
Sequence CCTCTTTTCATCCTGGGGACTGC CCTGGAGTCCAGCTGGGCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!