ID: 1145000659_1145000666

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1145000659 1145000666
Species Human (GRCh38) Human (GRCh38)
Location 17:19302290-19302312 17:19302325-19302347
Sequence CCGTCCCCATTCTGCAGATGAGA AGAAGGTAATCACCTAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 40, 3: 173, 4: 729} {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!