ID: 1145012541_1145012547

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145012541 1145012547
Species Human (GRCh38) Human (GRCh38)
Location 17:19378110-19378132 17:19378132-19378154
Sequence CCCAGACCTGGGCATCTCAGGCC CGGGCAGTTCCCCGAGCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 261} {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!