ID: 1145012886_1145012891

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145012886 1145012891
Species Human (GRCh38) Human (GRCh38)
Location 17:19379581-19379603 17:19379603-19379625
Sequence CCTGCCCCGCAGGGGAGTTGTGA AAGGTAACATTTAATAATGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 226} {0: 1, 1: 0, 2: 2, 3: 33, 4: 361}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!