ID: 1145014072_1145014085

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1145014072 1145014085
Species Human (GRCh38) Human (GRCh38)
Location 17:19385553-19385575 17:19385579-19385601
Sequence CCAGTTTGTTAAAGGACTGGGTT GGTGGGGAGGGTGGTGGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129} {0: 1, 1: 5, 2: 70, 3: 583, 4: 4753}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!