ID: 1145014072_1145014086

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1145014072 1145014086
Species Human (GRCh38) Human (GRCh38)
Location 17:19385553-19385575 17:19385580-19385602
Sequence CCAGTTTGTTAAAGGACTGGGTT GTGGGGAGGGTGGTGGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 129} {0: 1, 1: 1, 2: 34, 3: 296, 4: 2896}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!