ID: 1145023913_1145023926

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1145023913 1145023926
Species Human (GRCh38) Human (GRCh38)
Location 17:19453396-19453418 17:19453440-19453462
Sequence CCCCAGCTGCTGTGGGCCTCGTG TCCAGCAAAACCTCAGCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 215} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!