ID: 1145029629_1145029631

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1145029629 1145029631
Species Human (GRCh38) Human (GRCh38)
Location 17:19494992-19495014 17:19495005-19495027
Sequence CCTGCGGGTGGGCCTCTTGGACG CTCTTGGACGCAGCACCCTCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 9, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!