ID: 1145030527_1145030530

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1145030527 1145030530
Species Human (GRCh38) Human (GRCh38)
Location 17:19501571-19501593 17:19501596-19501618
Sequence CCTTCAGGGTTCAGTTTTCAAGT TGGTTGGAATTTGTCAGATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 203} {0: 1, 1: 0, 2: 1, 3: 14, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!