ID: 1145031293_1145031305

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1145031293 1145031305
Species Human (GRCh38) Human (GRCh38)
Location 17:19507277-19507299 17:19507316-19507338
Sequence CCTGGCCGTGGGCGTCGCCCTCC CCCCTGAGAGGAGAGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 168} {0: 1, 1: 1, 2: 4, 3: 55, 4: 578}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!