|
Left Crispr |
Right Crispr |
| Crispr ID |
1145032554 |
1145032562 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:19516042-19516064
|
17:19516058-19516080
|
| Sequence |
CCTATAATCCCAATGCCTTAGGA |
CTTAGGAAGGCCAAGGTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 155, 3: 1742, 4: 15232} |
{0: 2, 1: 70, 2: 2428, 3: 29389, 4: 86148} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|