ID: 1145036686_1145036690

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1145036686 1145036690
Species Human (GRCh38) Human (GRCh38)
Location 17:19545778-19545800 17:19545822-19545844
Sequence CCACACCTGGCCAACAATTCTTA ACACCAGAAATCCCATCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 70, 3: 463, 4: 2363} {0: 1, 1: 0, 2: 5, 3: 43, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!