ID: 1145037358_1145037360

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1145037358 1145037360
Species Human (GRCh38) Human (GRCh38)
Location 17:19550815-19550837 17:19550829-19550851
Sequence CCCTCTGCAGGTTGTCCCCTGTG TCCCCTGTGCATTCATCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 181} {0: 1, 1: 0, 2: 0, 3: 13, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!