ID: 1145037533_1145037541

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1145037533 1145037541
Species Human (GRCh38) Human (GRCh38)
Location 17:19551804-19551826 17:19551828-19551850
Sequence CCCATTTGCTCCTAAGACAGAGC CAGGCTGGGGGCAGCTCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 120} {0: 1, 1: 0, 2: 2, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!