ID: 1145037534_1145037541

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1145037534 1145037541
Species Human (GRCh38) Human (GRCh38)
Location 17:19551805-19551827 17:19551828-19551850
Sequence CCATTTGCTCCTAAGACAGAGCG CAGGCTGGGGGCAGCTCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90} {0: 1, 1: 0, 2: 2, 3: 20, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!