|
Left Crispr |
Right Crispr |
Crispr ID |
1145040986 |
1145040993 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:19578437-19578459
|
17:19578452-19578474
|
Sequence |
CCTTCCACCTTGCCCTCCCAAAG |
TCCCAAAGTGTTGGGATTATAGG |
Strand |
- |
+ |
Off-target summary |
{0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428} |
{0: 2339, 1: 52139, 2: 339839, 3: 240187, 4: 123501} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|