|
Left Crispr |
Right Crispr |
| Crispr ID |
1145040986 |
1145040996 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:19578437-19578459
|
17:19578471-19578493
|
| Sequence |
CCTTCCACCTTGCCCTCCCAAAG |
TAGGCATGAGCCACCACGACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428} |
{0: 7, 1: 699, 2: 11164, 3: 57062, 4: 144601} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|