ID: 1145040986_1145040997

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1145040986 1145040997
Species Human (GRCh38) Human (GRCh38)
Location 17:19578437-19578459 17:19578478-19578500
Sequence CCTTCCACCTTGCCCTCCCAAAG GAGCCACCACGACTGGCCAGAGG
Strand - +
Off-target summary {0: 7, 1: 1361, 2: 26677, 3: 81625, 4: 160428} {0: 1, 1: 17, 2: 243, 3: 955, 4: 2618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!