ID: 1145058183_1145058197

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1145058183 1145058197
Species Human (GRCh38) Human (GRCh38)
Location 17:19716626-19716648 17:19716663-19716685
Sequence CCCTGCCTGGGCAGCCCGTGTCG ATGAGTAAGGGGCAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 159} {0: 1, 1: 1, 2: 5, 3: 73, 4: 790}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!