ID: 1145070454_1145070459

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1145070454 1145070459
Species Human (GRCh38) Human (GRCh38)
Location 17:19801253-19801275 17:19801276-19801298
Sequence CCTAACAAATTTATACAGAGATT CTCAAAAAGAAGTTGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 445} {0: 1, 1: 0, 2: 7, 3: 66, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!