ID: 1145089250_1145089252

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1145089250 1145089252
Species Human (GRCh38) Human (GRCh38)
Location 17:19972981-19973003 17:19973003-19973025
Sequence CCACTACCTTTTGTTTTGTTTTG GCTTTAAGACTCCGTCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 74, 3: 475, 4: 3680} {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!