ID: 1145102530_1145102538

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1145102530 1145102538
Species Human (GRCh38) Human (GRCh38)
Location 17:20088828-20088850 17:20088869-20088891
Sequence CCTTTGGGAAGTCGGCCATGAGG GGATTGTGCTTGTGCAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 65} {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!