ID: 1145103405_1145103411

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1145103405 1145103411
Species Human (GRCh38) Human (GRCh38)
Location 17:20095570-20095592 17:20095588-20095610
Sequence CCTGTGGTTCTTCTCGTGGCTGG GCTGGCTAACGGGCTGTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 115} {0: 1, 1: 0, 2: 0, 3: 15, 4: 148}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!