ID: 1145110615_1145110625

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1145110615 1145110625
Species Human (GRCh38) Human (GRCh38)
Location 17:20158197-20158219 17:20158234-20158256
Sequence CCGAGGGTCATCAGAGCAAGGGG AGGGGGAAGCAGAAGGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179} {0: 1, 1: 1, 2: 26, 3: 337, 4: 2322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!