|
Left Crispr |
Right Crispr |
| Crispr ID |
1145111036 |
1145111047 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:20161868-20161890
|
17:20161916-20161938
|
| Sequence |
CCCTGCAACTTCTGCCTCCCAGG |
TCTTGAGTACCTGGGACTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
{0: 37, 1: 2645, 2: 53802, 3: 178185, 4: 229694} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|