|
Left Crispr |
Right Crispr |
| Crispr ID |
1145114790 |
1145114794 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:20199206-20199228
|
17:20199220-20199242
|
| Sequence |
CCTCCCAAGTAGCTGGAGTTACA |
GGAGTTACAGGCATGTGCTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 71, 1: 4069, 2: 60574, 3: 158229, 4: 269032} |
{0: 1, 1: 0, 2: 2, 3: 63, 4: 607} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|