|
Left Crispr |
Right Crispr |
| Crispr ID |
1145124575 |
1145124579 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:20289560-20289582
|
17:20289591-20289613
|
| Sequence |
CCCAAAAAGTGCTGGGATTAACA |
CTACTGTGCCTGGCCAAAAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 2, 2: 21, 3: 235, 4: 1379} |
{0: 1, 1: 5, 2: 62, 3: 310, 4: 955} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|